Mel1856
Mel1856 Mel1856
  • 04-11-2018
  • Mathematics
contestada

Please explain and answer without Euler’s number

Please explain and answer without Eulers number class=

Respuesta :

unicorngirl15
unicorngirl15 unicorngirl15
  • 04-11-2018

there are 8e+6 bits in a megabyte

Answer Link

Otras preguntas

Adam wants to compare the fractions three twelths ,one sixth ,one third. He wants to order them from least to greatest and rewrite them so they all have the sam
The sum of two numbers is 54. One number is 26 more than the other. Find the numbers.
Who is the most likely intended audience for Stanton's declaration? A. all men B. all women C. men in public office D. women in public office E. men and women i
Which is true of European education in the Middle Ages?
As the solar nebula contracts during the formation of the solar system, it Group of answer choices forms a black hole. flattens out into the ecliptic plane and
What does a pyramid of biomass represent
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
What is 5/15+3\5=? For the sum
Besides water, what is the product of a Neutalization Reaction between HBr and CsOH?a. HCSb. BrCsc. BrOHd. CsBr​
A family went to a baseball game. They parked the car in a parking lot which charged ​$20. The cost per ticket was ​$27. Write an equation for the total cost of