zoiejo2005
zoiejo2005 zoiejo2005
  • 01-03-2019
  • Mathematics
contestada

Please help an 8th grader out.

Please help an 8th grader out class=

Respuesta :

quinnxhailey
quinnxhailey quinnxhailey
  • 01-03-2019

Answer:

B at 4.7

Step-by-step explanation:

The square root of 22 is about 4.69. Rounding this, you get 4.7

Answer Link
puppyloverls3 puppyloverls3
  • 01-03-2019

Answer:

B

Step-by-step explanation:

the square root of 22 is 4.690. . . . .   round that to 4.7

Answer Link

Otras preguntas

Application of force with movement is called _______________ exercise.
The name for people who stay in one place like civilization of china and kroea
circadian rhythm refers to
how is mechanical weathering best described A. The buildup of chemical deposits on the surface B. The breakdown of rock through mechanical disintegration and ph
Which sentence best describes how a business letter should be written? A business letter should have its body aligned to the right margin of the page. A busines
Brainliest, what is the total measure of angles 8 and 5 of angle 7 equals 61
zach has 8 stores that he manages 6 of those stores are hiring what fraction of his stores are hiring?
What two molecules are produced by the light reactions and used to power the calvin cycle?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
how is an error within an EMR corrected