2cutetianna 2cutetianna
  • 02-05-2016
  • Mathematics
contestada

how do you write 60,000 drive 1,000 drive by5,00+20+2 in standard form

Respuesta :

jasonsuarez
jasonsuarez jasonsuarez
  • 02-05-2016
60000 that would be it because u have nothing else to put in standered form in
Answer Link

Otras preguntas

How did the mountains in Greece contribute to the rise of city-states?
what is the geometric mean between 6 and 20?
Compliant is to stubborn as excited is to
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
In a standard dictionary, where can you find the key to pronunciation marks? A. In an appendix B. In the front of the dictionary C. At the bottom of each page D
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
why is the square root of a perfect square always rational
Which word has the long e sound? a. client b. inferior c. beautiful d. poetic