sleep1269 sleep1269
  • 02-01-2020
  • Social Studies
contestada

Which of the following best describes when a protocol may be eligible for expedited review by the IRB?

Respuesta :

josephsmith041496
josephsmith041496 josephsmith041496
  • 06-01-2020

Answer:

The study involves no other minimal risk and then meets one of the legible categories of expedited review authorized by the federal government.

Answer Link

Otras preguntas

Do you think then solid can undergo convection
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?
Solve the equation -10 + 3x + 5x = -56 ? ??
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
What is the difference between "Herr" and "Herrn"?
Companies raise funds to expand their business by
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article