jenna9173 jenna9173

04-03-2020
Law

contestada

3. What is the president's purpose in the State of the Union speech?

Respuesta :

04-03-2020

Answer: The president talks about important issues facing our country and offers his ideas of addressing these issues amd plans for the future to make improvements.

Explanation:

Answer Link

Otras preguntas

What is the name for the transfer of genetic information from one bacterium to another bacterium by a phage? select one: a. transduction b. translation c. penet

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

A map has a scale of 6 in : 26 mi. If Clayton and Clinton are 52 mi apart, then they are how far apart on the map?

Why do you think it is a good idea to soak wilted lettuce in cool water before serving it?

Why do you think the Little Rock Nine deserve to be admired? Give two reasons for your opinion.

Toco el piano _______________ hace dos meses. desde se les por

Everfi the person who receives financial protection from a life insurance plan is called a:

What was the extent of islamic expansion one century after muhammad's death?

Read the passage from “Cruel Tribute.” Years passed by. Every spring when the roses began to bloom seven youths and seven maidens were put on board of a black-s

What is foster’s overall point about journeys or trips in literature?