lenaangel
lenaangel lenaangel
  • 02-09-2020
  • Mathematics
contestada

Solve for x: 4(x + 2) = 3(x - 2)
-2
-4
-10
-14

Respuesta :

vazquezallison529 vazquezallison529
  • 05-09-2020

Answer:

x=-14

Step-by-step explanation:

Answer Link

Otras preguntas

omg please help why do i have these weird bumps on both of my arms but i didn’t even do anything i was just laying in bed am i having an allergic reaction to so
can someone please do this for me, i will give out brainliest!!!! ASAP
what are the primary functions of dermis
a system of shared beliefs and values that develops within an organization and guides the behavior of its members is called organizational ______.
Order the items from most general to most specific.snakereptile python animal​
What is the definition of undefined term? A. A statement in which the hypothesis and conclusion are switched B. A statement that describes the qualities of an i
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
PLS ANSWEE! B. Two angles that share a common vertex and side. Geometry vocab
what is y-intercept of this problem​
Which point is on the graph ofx=13(y−18)in the coordinate plane?