bschevelle bschevelle
  • 03-10-2016
  • Social Studies
contestada

sea breezes are caused because what

Respuesta :

xxeitharredstar
xxeitharredstar xxeitharredstar
  • 03-10-2016
Sea breezes are caused because the land heats and cools more quickly than the water
Answer Link

Otras preguntas

the length of a rectangle is twice its width. If the area of the rectangle is 50 ft ^2, find its perimeter.PLEASE HELP!!!!!!!!REALLY IMPORTANT HAVE TO FINISH MY
The area in a multipolar neuron that connects the cell body to the initial segment of the axon is called the ________.
Dr. shiguli wants to determine the lightest touch that can be felt by various animals compared to human beings. he would therefore be interested in finding the
For how many different values of θ between 0 and 2π radians is sec x = csc x ?
Can you help me to find this answer, please, I need help
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
The textbook defines _____ as a cluster of characteristics that are associated with all members of a specific social group, often including qualities that are u
If a family has three children, what is the probability that the family has at least one girl?
A major difference between major depressive disorder and bipolar disorder is that only in bipolar disorder do people have _____. a. hallucinations or delusions
Find the missing length indicated