vikky85 vikky85
  • 03-12-2020
  • Chemistry
contestada

help with this question

help with this question class=

Respuesta :

vinny1203 vinny1203
  • 03-12-2020
Complementary DNA strand have the letters switched from each other. That would be:

A -> T OR T -> A
And
C -> G OR G -> C

As well as the direction of the strand:
5’ -> 3’ to 3’ -> 5’


For the first set:

DNA: 5’ - ATTATCGCGTAGCTAGCAGT - 3’
Comp: 3’ - TAATAGCGCATCGATCGTCA - 5’

As you can see the strands are the opposite from one another.

Try out the second set of strands and if you’re still having struggles let me know in the comments (:
Answer Link

Otras preguntas

a carpenter who is installing cabinets uses thin pieces of material called shims to fill gaps. the carpenter uses four shims to fill a gap that is 1.2 centimete
What is 6,007,200 and 32,005,008 in expanded form?
How to use oder of operations??
what is 829 rounded to the nearest hundred
use the word emphasis in a simple sentence
How to do criss cross multiplication
Job A pays $13.00 per hour. Job B pays $11.00 per hour but has health benefits. Health insurance costs $3,400 per year. You expect to work 2,000 hours during th
why did some members of congress oppose lincoln ten percent plan?
connecting the past to the present helps you to know how people have ?
Ted says that 3 tenths multiplied by 100 equal 300 thousandths. Is he correct? Use place value chart to explain your answer.