nathanone06 nathanone06

03-03-2021
Mathematics

contestada

Decide if the function is an exponential function. If it is, state the intial value and the base. y = 5 ^ x

Decide if the function is an exponential function If it is state the intial value and the base y 5 x class=

Respuesta :

diamondmatrx diamondmatrx

03-03-2021

Answer:

B

Step-by-step explanation:

Answer Link

Otras preguntas

If 4.1 × 1021 electrons pass through a 40 Ω resistor in 5 min, what is the potential difference across the resistor? The fundamental charge is 1.602 × 10−19 C .

For g(x) = 3(64)*, find the following. g(-1/3)

A company makes computer chips from square wafers of silicon. It wants to keep the side length of a wafer very close to 20 mm and it wants to know how the area

I need help again lol.... A.) SSS Postulate B.) ASA Postulate C.) AAS Theorem D.) SAS Postulate

Terms that have identical variable parts or two or more constant terms

A dressing is loose. What can happen?

What are the capitals of the two states that contain the word "north?" A Raleigh, Columbia B Pierre, Columbia C Raleigh, Bismarck D Bismarck, Pierre

Lithium has two stable isotopes with masses of 6.01512 amu and 7.01600 amu. The average molar mass of Li is 6.941 amu. What is the percent abundance of each iso

Future space stations will create an artificial gravity by rotating. Consider a cylindrical space station 780 m diameter rotating about its central axis. Astron

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template