rjai591867 rjai591867
  • 04-05-2021
  • Mathematics
contestada

Write an equation for the line of fit for this data in form of y=mx+b. Where x is latitude and y is temperature

Write an equation for the line of fit for this data in form of ymxb Where x is latitude and y is temperature class=

Respuesta :

nayeli832586 nayeli832586
  • 04-05-2021
Y=7/5x +120 I hope this helped :)
Answer Link

Otras preguntas

a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?
what is the geometric mean between 6 and 20?
which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
what is the geometric mean between 6 and 20?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Solve the equation -10 + 3x + 5x = -56 ? ??
what is 0.00001267 is scientific notation
Who was the Queen of England when Shakespeare first became known as a great playwright? A. Elizabeth I B. Mary Tudor C. Victoria D. Anne Boleyn