25tuckhannah 25tuckhannah
  • 01-09-2021
  • History
contestada

This reading was about the revolution of 1848. What was the effect of this uprising in Germany?

Respuesta :

HistoryDoctor71
HistoryDoctor71 HistoryDoctor71
  • 01-09-2021

Answer:

A.  The revolutionaries failed to achieve their long-term goals.

Explanation:

The uprisings led to little political change but had a significant social and cultural change. Some reforms lasted and brought with them certain changes such as the abolition of serfdom in Austria and Hungary, the end of absolute monarchy in Denmark, and the introduction of representative democracy in the Netherlands

Answer Link

Otras preguntas

A video camera and a computer.​
paula has read 70% of the total pages in a book she is reading for english class
A group of college students are going to a lake house for the weekend and plan on renting small cars and large cars to make the trip. Each small car can hold 5
what is 8/35 pls help me
convert .375 to a percent ​
why do we get multiply xy × xy × xy​
The alveoli are surrounded by carrying blood to and from the heart. A) vena cava B) bronchioles blood vessels D) white blood cells
Que motivo a los Vikingos a efectuar tan largas travesías?
the euskara language is better known by what name?
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'