mxrah
mxrah mxrah
  • 03-09-2021
  • Chemistry
contestada

Can u guys help I keep forgetting this

Can u guys help I keep forgetting this class=

Respuesta :

nguyenhonganh190407
nguyenhonganh190407 nguyenhonganh190407
  • 03-09-2021

Answer:

2,4  

Explanationvì    :

  vì

âậymà

 

Answer Link

Otras preguntas

describe how the resistance of the filament lamp changes as the current through it increases.
What are the asymptotes of the hyperbola with equation 9y^2 - 4x^2 = 36?
Write a compound inequality that the graph could represent.
please answer this im dying here
A penny fell off the top of the building and hit the sidewalk below 3.1 seconds later how many meters did the penny fall to the sidewalk
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
the push or pull that exists between interacting objects is
Which Romantic poet said, “I think I shall be among the English Poets after my death,” before dying of tuberculosis at 25? A. Lord Byron B. Samuel Coleridge
Quadrilateral abcd is inscribed in this circle. what is the measure of angle a?
what is x? using the picture below and directions