yougayybro yougayybro

04-06-2022
Biology

contestada

What are the three techniques scientists can
use for correlation ? (fossils)

Respuesta :

anais111 anais111

04-06-2022

Types of Correlational Research. There are three types of correlational research: naturalistic observation, the survey method, and archival research.

Answer Link

Otras preguntas

Please helppppppppppp meee

could someone please help me put these in order? i tried once already and messed up a few

Which object has a mass of about 1 kg

In Erica's toy bin there are 4 red blocks. There are 18 more yellow blocks than red blocks. There are also 20 more blue blocks than red blocks. How many blocks

Which of the following best describes how Esperanza and her friends 'try on a different reality' in their neighborhood? A. They talk to the girls in the neigh

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

What happens to the value of f(x) = log2x as x approaches O from the right?

Which of the following is an example of negative correlation? a. People who spend more time exercising tend to weigh less. b. Teenage females tend to have fewer

Write this word sentence as an inequality. A number y is greater than 1 and is less than or equal to 8 .

What is the purpose of this sentence within the context of the entire essay? A) This is Twain's evidence for all of the main ideas in his essay. B) This is Twai