EllyS88489 EllyS88489
  • 03-11-2022
  • Mathematics
contestada

simplify the expression so there is only one positive power for the base -5

simplify the expression so there is only one positive power for the base 5 class=

Respuesta :

XandyrL471982 XandyrL471982
  • 03-11-2022

When we are dividing, exponents are subtracted!

The rule is shown below:

[tex]a^b\div a^c=a^{b-c}[/tex]

We can apply this rule to this problem as shown:

[tex]\begin{gathered} -5^7\div-5^2 \\ =-5^{7-2} \\ =-5^5 \end{gathered}[/tex]

Answer Link

Otras preguntas

Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
who was the founder of Pennsylvania?
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
In which system of government would states function independently of each other?
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
i need help with #3
the perimeter of a square 116ft ?
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5