farttopoop farttopoop

03-04-2017
Mathematics

contestada

what is the volume of a box that has the length of 7cm width of 6 cm and a height of 3 cm

Respuesta :

N3gat1veZer0 N3gat1veZer0

03-04-2017

The volume of a box is the length times the width times the height. So
Volume = 7 x 6 x 3

Answer Link

Otras preguntas

Someone please help me on this problem.. :(

what is - 5 = -2 what is the questionwhat is the question

Frost forming on a car's windshield is a chemical change True or false

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

-2/8, -0.2, -3/7 from least to greatest???

aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa chose all that apply

a boa constructor is 18 inches long at birth and grows 8 inches per year. Write an equation in slope intercept form that represent the length of a boa constrict

Please answer both question above and below A trapezoid has bases that measure 9 cm and 5 cm. The height of the figure is 4 cm. What is the area of the trapez

eins What is this number in german?

4. Now that we allow the children of illegal immigrants to attend public schools, it's only a matter of time before those kids grow up and vote for candidates w