marcieself5314 marcieself5314

04-04-2017
Social Studies

contestada

What is the role of the press secretary

Respuesta :

Insanity Insanity

04-04-2017

The press secretary is the person who talks to the press or media about topics. He is the president's spokesperson when he is busy.

Hope this helps!

Answer Link

Otras preguntas

Yahaira is ready to reach the next level in her fitness. She is in great shape, but she still lacks the power needed to lift heavy objects. Which of the followi

Write a compound inequality that the graph could represent.

What happens when energy is changed from one form to another? a. a physical change to a substance occurs. b. all of the energy can be accounted for. c. all of t

Towards the end of Anne's diary, her entries stop being about her relationship with Peter and focuses more on what? the burglaries in the house the food

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

the spread use of chop sticks into southeast asian countries with the influx of chinese migrants there is an example of which of the following concepts A. Stim

Biggest reason why the united states did not want to enter world war 1

Your religious identity is only important for you within your family and does not matter in the public sphere.

How far away is the next Earth-like planet in light years? What does this seem unlikely that it won’t be a manned space mission?

The element with the most stable nucleus and smallest mass per particle is