ppricilaahhhh ppricilaahhhh
  • 03-10-2017
  • Mathematics
contestada

What is the answer show your work plz

What is the answer show your work plz class=

Respuesta :

ItsMakenzy
ItsMakenzy ItsMakenzy
  • 03-10-2017
Hope this helps! Let me know if you have any more wuestions
Ver imagen ItsMakenzy
Answer Link

Otras preguntas

Read the following passage written by a teen hero: I want to be a vocal advocate for nature. I reject the idea that I am too young to make a difference. I recen
Molly is buying a house for $202,000. she is financing $185,500 and obtained a 30 year fixed rate mortgage with a 5.125% interest rate. How much are her month
How do you determine the type of ion charge any element will form based on its number of valence electrons?
1. Find the missing side length. A. 12 in B. 15 in C. 17 in D. 21 in 2. Find the missing side length. A. 25 m B. 20 m C. 75 m D. 100 m
Please someone help me with this
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Paul has grades of 86 and 85 on his first two tests. what must he score on his third test in order to have an average of at least 90
In the Chinese civil war 1945-1949 support for Mao Zedongs communist forces came primarily from the
which goal stated in the preamble to the u.s. constitution requires a strong army
What are some examples of dramatic irony in The Hobbit?