ernaan234 ernaan234

03-11-2017
Biology

contestada

What are two raw materials necessary for the process of photosynthesis?

Respuesta :

yaka2519 yaka2519

03-11-2017

The plant also takes in raw materials from the environment, water through its roots and carbon dioxide moves into the stomata by diffusion.

Answer Link

Otras preguntas

The length of a rectangular garden is 4 m greater than the width. the area of the garden is nbsp 60m squared . find the dimensions of the garden.

I=$310 P=$1,000 t=5 years

Helena has five different flowers. She plans to give one flower to each of her five teachers in any order. She gives the first flower to one of her teachers in

Does the increase in blood glucose levels increase the viscosity of the blood

Explain how infection prevention policies and guidelines can be applied in own work setting.

It takes 1 1/2 cups of flour, 1 1/4 cups of sugar, and 1/2 cup of butter to bake fifteen shortbread cookies. If Ramon has 5 cups of flour, 4 cups of sugar, and

The Hellenistic age was characterized by all of the following EXCEPT

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

PLEASE HELP!!!!!!!!!!!!!!! Mongol conquests ranged from East Asia to Eastern Europe during the thirteenth and fourteenth centuries. This relatively short period

What is true concerning an ecological community? it is a large region of multiple organisms the boundaries, large or small, of a single organism the ecosystem o