MisnersLady MisnersLady
  • 04-02-2014
  • Mathematics
contestada

what is 20% of $45.00?

Respuesta :

binax1 binax1
  • 04-02-2014
It is 9$ :)

45*0,2=9

YW
Answer Link
Ry22 Ry22
  • 28-01-2020

Answer:

9

Step-by-step explanation:

45*.2=9

To make a percent a decimal move the point over two units:

20.00%

2.000- 1 unit

.2 is  2 units = 20%

Answer Link

Otras preguntas

The group that receives the treatment or test stimulus or factor under study is called the
What are the different ways of interpreting the title of the short story was it a dream
Solve the given inequality and graph the solution on a number line. I need it on a graph -x/2 +3/2 <5/2
Explain the carbon cycle and explain why burning fossil fuels is an issue.
The introduction of the Green Revolution in India was intended to
Compare or Contrast - Jack London's "War" and Ambrose Bierce's "Horseman in the Sky." DUE TODAY!!!
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Does the increase in blood glucose levels increase the viscosity of the blood
Don’t know how to this, solve for x
Pete slid a domino off a bridge and it took 2.3 seconds to hit the Gully below how many feet did the domino fall