carolineabigail1 carolineabigail1
  • 03-01-2018
  • English
contestada

Use the future perfect progressive form of play to complete the following sentence. I _____ guitar for six years this coming May.

Respuesta :

jewelsofgold jewelsofgold
  • 03-01-2018
I will have been playing guitar for six years this coming May.

Future perfect progressive form = will/ shall + have been + -ing form of verb
Answer Link

Otras preguntas

what might be learned from an incorrect hypothesis
4x-2y=14 y=1/2x-1 Solve the system of linear equations by substitution. Check your answer.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
What is the difference between "Herr" and "Herrn"?
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
a antonym for biosphere
Tu as quels cours le jeudi matin?