malshawa2005p85w7y malshawa2005p85w7y

03-05-2018
Mathematics

contestada

what is 4/9x+7=1/2 and plz give me full steps

Respuesta :

fatehahnordin9p7wo43 fatehahnordin9p7wo43

03-05-2018

4/9x+7=1/2
4/9x 7 = 1/2
8x + 7(2)(9) = 9
8x + 126 = 9
8x = 117
x = 14.625

Answer Link

Otras preguntas

When Sanchez left his house this morning, his cell phone was 30% charged and it then started to lose 3% charge for each hour thereafter. Write an equation for t

Tara is shown a picture of a dart board along with some dimensions. She knows that each triangular section in the dartboard is congruent. What is the approximat

What is the volume and surface area?

Who many countys make up East Asia

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

A computer and printer cost a total of 1218. The cost of the computer is two times the cost of the printer. Find the cost of each item.

Tanner-UNF Corporation acquired as a long-term investment $240 million of 7% bonds, dated July 1, on July 1, 2018. The market interest rate (yield) was 9% for b

Which experiences or strenghths did LBG bring to the presidency?

Sophia creates a blog about food specialties and how to make them at home. In one session she shares a recipe from her grandmother in Italy about making genuine

Analysis: Marble is made from limestone under the influence of heat and pressure. The chemical formula for limestone or marble chips is CaCO3. When you added th